ENCRYPTING INFORMATION USING DNA SEQUENCE WITH MATRIX ALGEBRA

[Audio] Good morning everyone. Today I am here to talk to you about a unique method of encrypting data using DNA sequences and matrix algebra. I will explain how this method works and the potential implications and applications for its use. I look forward to this discussion..

[Audio] Discussing the research paper from Research Gate by Menaka Krishnamurty published in November 2023, it looks at how DNA Sequences can be used to encrypt data for increased security. Matrix Algebra is proposed to reduce the complexity of the encryption process. Data used in the research came from Nupur Sandeep Koli's roll number TS110 taken from Bhavans College Andheri (W). The results from this research paper hopefully can be used to improve security measures in the future..

[Audio] Using DNA sequence and matrix algebra, highly reliable encryption of large data can be achieved. This method requires less energy and creates a comprehensive structure making it difficult for outside parties to decipher. Its significance in the area of data security is undeniable..

[Audio] Encryption is the process of transforming information into a code that can only be read by the intended recipient. Plaintext is the original message that the sender wishes to transmit whereas ciphertext is the final, encoded version of the message, created through the use of encryption. To encrypt data, a mathematical algorithm is used which renders it into an unreadable form. To access this encrypted information, a secret key which is known only to the intended recipient is required, which then decrypts the ciphertext into plaintext. Encryption can be used effectively to keep information secure in the digital world..

[Audio] DNA is increasingly becoming a viable option for data storage due to its capacity to be encrypted using matrix algebra. DNA is composed of phosphate molecules, deoxyribose sugar molecules, and four nitrogen-containing bases – adenine, guanine, cytosine, and thymine. These bases form complimentary pairs, such as adenine and thymine or guanine and cytosine. It is possible to use matrix algebra to encode data onto these base pairs, allowing DNA to be used for secure encryption. This technology has the potential to revolutionize the data storage and exchange process, offering unprecedented security and storage capacity..

[Audio] Proposed methodology consists of converting plaintext into its equivalent ASCII representation and then to binary code, to DNA form of data and finally into a encrypted message. A key matrix is used to aid in the XOR operation which is then written in series form, thus obtaining the encrypted message. This technique is an effective way to protect data from unauthorized access and enable its secure transmission..

[Audio] We jump to our seventh slide which focuses on the first step of the project: accepting a message from the user. This message can be alphanumeric or of any other type. As an example, we can take Neha wishing to securely send the message “HELLO” to Arun using our DNA cryptography and matrix algebra. Therefore, “HELLO” is the accepted message..

[Audio] Using a conversion process, we can translate accepted text into its ASCII form. For instance, the word 'Hello' would be denoted as 72 69 76 76 79. This is done by assigning each letter of the word an equivalent numerical value in the ASCII code, which allows for the word to be broken down into individual numbers..

[Audio] In this step, we convert the ASCII code into its equivalent binary form. This allows us to represent the code with base two numbers, so as to use matrix algebra to encrypt it. For example, if the ASCII code is "72 69 76 76 79", the equivalent binary code is "01001000 01000101 01001100 01001100 01001111.

[Audio] We'll move on to our fourth step - converting binary to its equivalent DNA form. A DNA form table is used for this, translating two digits of a binary code to its matching DNA form. An example of this is the code "01001000" which becomes "CAGA". This step is essential when encrypting information using DNA sequence, involving matrix algebra..

[Audio] We go into Step 5 by applying complementary rules to transform the DNA structure into DNA code. The three different rules of complementarity being A is paired with G, G with A, T with C, and C with T. This allows us to encode our information into the DNA sequence as well as using matrix algebra for encryption..

[Audio] There are two fundamental rules when encrypting information using DNA sequence with matrix algebra. Rule one states that A is paired with T and T is paired with A, as well as G is paired with C and C is paired with G. Rule two states that A is paired with C and C is paired with A, as well as G is paired with T and T is paired with G. To illustrate, taking the DNA form of the message CAGA CACC CATA CATA CATT and applying Rule 1, the DNA code becomes TGAG TGTT TGCG TGCG TGCC. This demonstrates how DNA sequencing can be used effectively for encrypting data..

[Audio] DNA is a powerful tool for encrypting information, and in this step we employ its code to identify the transitions between the bases - A, T, G, and C. As an example, the sequence TGAGTGTTTGCGTGCGTGCC would garner zero transitions from A to A, zero transitions from T to A, one transition from G to A, and so on. Through this step, a matrix of all possible transitions can be created to further encrypt the information..

[Audio] We explored how we can encrypt a message using DNA Sequence and Matrix Algebra. The last step is to write the transitions in form of a matrix called the Transition Proposition Matrix. This matrix contains the number of transitions from one nucleotide to the other. From the table, we can see there are 0 transitions from A to A, 0 transitions from C to A, 1 transition from G to A and so on. This enables us to achieve a secure message encoded in a DNA sequence..

[Audio] A key can be generated by randomly choosing numbers 0 to 9 and creating a matrix from them. A table showing this data is presented on the slide. This key in matrix form assists in encrypting information using DNA sequence and matrix algebra..

[Audio] Encryption of information using a DNA sequence and matrix algebra is a fascinating and intricate procedure. In this slide, we will review step 9, which entails the use of XOR operation for encryption. For this particular step, we convert every element in the transition proposition matrix and key to its 8-bit binary representation. Following this, we use the XOR logic table to carry out XOR operations. To illustrate, if C and D are both 0, the XOR result would be 0. Should C be 1 and D 0, the result would be 1 and so on. Through XOR operations as described, the message can be transformed into its final form..

[Audio] Matrix algebra can be used to encrypt data by combining two tables into a single sequence. The tables, divided into rows and columns, represent the data which is then formed into a DNA sequence. This secure encryption of data allows for its transmission across digital networks with assurance of its security and safety..

[Audio] Matrix Algebra can be used to encrypt a given DNA sequence into a table of data with values 4, 0, 0, 2, 1, 5, 1, 1, 1, 5, 2, 5, 5, 3, 4, 2. This data serves to protect confidential information and increase the efficiency and safety of communications between two entities. The data is encoded in such a way that only the recipient possessing the correct encryption key is able to decode it..

[Audio] Encryption is the process of translating meaningful information into an unreadable format, so that unauthorized users cannot access it. Using DNA matrices with algebra is an increasingly popular way to implement encryption. This method takes advantage of the mathematical properties within DNA sequences and matrix algebra to create a secure algorithm. Numerous studies by experts in the field such as Leuenberger, Adelman, Tushar Mandge, Vijay Choudhary, Bibhash Roy, Eugene Hossain, and other scientists have shown its effectiveness. This method of encryption takes advantage of molecular codes to generate a dynamic unique key for each user, granting secure and reliable protection to sensitive information..

The ground is open for any queries..

THANK YOU.