Scene 1

An  e lectrochemical  DNA biosensor for Yellow rust detection in wheat

Rizwana   Rehsawla Ph.D.  CCS Haryana Agricultural University,  Hisar , India

Stripe rust: A new challenge to wheat yield in New York – What's Cropping  Up? Blog

Scene 2

Food security is the major disquietude across the globe due to elevating population in recent years. In future, by the year 2050, the population is likely to reach 8 to 10 billion people. The food security is determined by adequate food production and supply to hungry people which place an unprecedented pressure on agriculture (Roberts  et al.,  2018).  Among various biotic constraints, rust diseases have been a major concern and problem for breeders, farmers and commercial seed companies over years (Marsalis and Goldberg, 2006).    3 species of rusts which infect wheat are : Stripe rust, commonly known as yellow rust ( Yr ) or “ Pilliya ” is one of the most widely devastating disease in the major wheat producing regions like China, India, US, Australia and the middle east

Scene 3

Yellow  (or stripe) rust caused by  Puccinia striiformis F. sp. Tritici ( Pst ),  is an airborne disease of wheat causing yield losses worldwide. The yellow rust spores travel longer distance and the ability of pathogen to mutate and multiply makes it a devastating disease .   Use of conventional plant breeding and pathology assays led to wheat improvement for yellow rust, however these are time consuming and cumbersome. Therefore, it is important to develop a cost-effective, non-invasive, sensitive and accurate assay for early detection of yellow rust.  DNA-based methods such as conventional PCR  have revolutionized plant disease detection, they are not very reliable at asymptomatic stage, especially in case of pathogen with systemic diffusion. They are relatively difficult to operate, costly, require expert technicians and are time consuming for data analysis.

Scene 4

What  happens when pathogens attack a plant?  An attack by disease-causing organisms generates a complex immune response in a plant, resulting in the production of disease-specific proteins involved in plant defense and in limiting the spread of infection. Pathogens also produce proteins and toxins to facilitate their infection, before disease symptoms appear. These molecules play vital role in the development of plant diagnostic kits. Biosensors have been used for detection of human and animal diseases. However, reports on plant pathogen detection using biosensors are limited.  Immunological assays have been used as diagnostics, recently DNA based biosensor are in demand due to their sensitive and accurate detection of DNA target sequences.

Scene 5

Electrochemical biosensors provide an attractive means to analyze the content of a biological sample due to the direct conversion of a biological event to an electronic signal.

Scene 6

Probe DN A 5’-/5AmM6/TCTCTTAGTAACTGTCCTCAAACTTTAGTTACCAATATAGAGATCTGAGC T arget  DN A AGAGAATCATTGACAGGAGTTTGAAATCAATGGTTATATCTCTAGACTCG      Probe DN A (MicroRN A  b a sed ) 5’-/5AmM6/ AGGTATAACCATTCCTCACCATTTCCTTCCTTGTCTCTTCCCTTTAGTTA T arget  DN A TCCATATTGGTAAGGAGTGGTAAAGGAAGGAACAGAGAAGGGAAATCAAT Probe DN A RJ4 5’-/5AmM6/ CATCACGACACCACCACCACCACCACCACC T arget  DN A GTAGTGCTGTGGTGGTGGTGGTGGTGGTGG

For  the detection of  Pst , oligonucleotide sequences specific to  Pst  were identified and used as probes for the detection. The probe sequences were modified at 5’ end by amino group. The complimentary sequences were used as targets to study electrochemical response after hybridization

Scene 7

For the detection of yellow rust we have fabricated  NiO /ITO thin film based matrix for developing highly sensitive DNA biosensor for detecting this disease.  A  number of  ss -DNA oligonucleotide sequences related in pathogenesis of yellow rust have been employed as probes for sensing. These were immobilized over the surface of Ni/ITO electrode via. physical adsorption . Potentiostat  was used to detect electric current generated from oxidation and reduction after immobilization of probe and hybridization with the complementary target DNA on electrode.  The  ss -DNA/ NiO /ITO bio electrode response studies were performed using cyclic voltammetry (CV) and differential pulse voltammetry (DPV) in the methylene blue (MB) mediated buffer.  Linear  response over wide DNA concentration range was obtained with a high sensitivity.

Scene 8

Thin film deposition:  The  nanostructured  NiO  thin film matrix was developed using RF sputtering technique. Substrate used:  ITO glass (2 cm ×1 cm) Target  used:  High purity (99.9999%) Nickel film (100 nm),  Gas used:  Oxygen

Sputtering process is done in vacuum chamber The base pressure in vacuum was around  6×10-6Torr Non- inert gas- oxygen was introduced continuously to achieve oxygen atmosphere The pressure during the deposition is approximately 30  militorr  in the chamber

Mechanism of Sputtering for thin film deposition

Scene 9

Sputtering target is negatively charged and plasma is consist of positively charged ions and free electrons. Positively charged ions are attracted towards the target and Strike the target    Atoms and molecules of target dislodge (in a way it resembles the game of billiards.) Dejected  NiO  atoms deposited on to the substrate placed opposite to the sputtered target.

High volt age is  applied to the target that creates plasma.  Alternating current of a range of RF is applied RF power of 40 W was applied to the target (voltage is depend upon the material used and the size of the target.

Scene 10

Scene 11

Half area of substrate (1cm x 1 cm) was masked by aluminum foil to retain its electrical conductivity required during electrochemical study.

Scene 12

Fabrication of  ss -DNA on  NiO /ITO electrode

Immobilization of 10  μl  of DNA probe solution ( ss -DNA, ) was done over the fabricated  NiO /ITO electrode

The immobilization of DNA onto  NiO /ITO occurs via. electrostatic interaction between positively charged  NiO   and negatively charged DNA

To remove the unbound probe from the bioelectrode, several washings with TE buffer were done followed by drying in air .

Scene 13

Incubate the target DNA sequence of desired concentration for 30s at room temperature

Seve r al washing of hybridized electrode to remove unbound  ss -DNA

Scene 14

Schematic representation of  biosensing  mechanism for  ss -DNA and ds-DNA on  NiO /ITO electrode with MB as redox indicator

Scene 15

Cyclic  Voltammogram  with different concentration of target DNA using 1mM of methylene blue.

Scene 16

Scene 17

The reproducibility of the experiment was also studied. To check the reproducibility, five  NiO /ITO electrodes under similar processing conditions were prepared. 10 µl of (50 ng/µl) probe DNA solution was used to immobilize all the five electrodes. For hybridization, 50 ng/ μl  target DNA concentration was used. The results showed almost similar  electrochemical   response towards complementary target DNA within 5% RSD. The results indicated the good reproducibility of the DNA biosensor.

Scene 18

Our study is one of its kind for detection of yellow rust in  wheat.  For  the detection of yellow rust  NiO /ITO thin film based matrix was fabricated for developing highly sensitive DNA biosensor for detecting yellow rust. Different sequences of  Pst  specific genes were used as probes for the biosensing response. Linear response over wide DNA concentration range (from 10  pg / μl  to 115ng/ μl ) was obtained with a high sensitivity, accuracy and reproducibility. The lowest detection limit was observed for microRNA like RNA 1 gene i.e. 10  pg /µl.

An electrochemical DNA biosensor for Yellow rust detection in wheat

Page 1 (0s)

Page 2 (41s)

Page 3 (1m 38s)

Page 4 (5m 34s)

Page 5 (6m 59s)

Page 6 (7m 51s)

Page 7 (12m 51s)

Page 8 (16m 43s)

Page 9 (21m 43s)

Page 10 (22m 20s)

Page 11 (23m 49s)

Page 12 (24m 13s)

Page 13 (28m 30s)

Page 14 (28m 59s)

Page 15 (33m 59s)

Page 16 (38m 59s)

Page 17 (43m 16s)

Page 18 (45m 30s)